| NRL PROBE-2 | |
| 62658 | |
| Human | |
|
|
| View expression in a second eye sample | |
| More Informations About This Gene | |
| View Sense Control | |
| Template Source: | |
| PCR product using the following primers: Primer-F: GCTGAGCAGAGGCACCAGGC Primer-R: TTCAGAAATGGCCGAGAGGA |
|
| Template Size (bp): 104 | |
| View Template Sequence | |
| Polymerase used to generate antisense riboprobe: T3 | |
| Polymerase used to generate sense riboprobe: T7 | |
| Hybridization Temperature: 65 | |