Home >> Gene List Table >> RPGR-ORF15
RPGR-ORF15 Gene
     
     
Human   Mouse

Click on the picture to see a full view
 
Click on the picture to see a full view
View expression in a second eye sample    
     
     
More Informations About This Gene   More Informations About This Gene
View Sense Control   View Sense Control
Template Source:   Template Source
genomic PCR product obtained by using:

Primer-F: AAAGGATCTGTGAAATATGG
Primer-R: AAATTAATTTTAAAGTGTAA
  plasmid kindly provided by Dr Alan Wright (Hong DH, et al. Invest Ophthalmol Vis Sci. 2003;44(6):2413-21.)
 
 
 
Template Size (bp): 1080   Template Size (bp): 1484
View Template Sequence   View Template Sequence
Polymerase used to generate antisense riboprobe: T3  

Polymerase used to generate antisense riboprobe: SP6

Polymerase used to generate sense riboprobe: T7   Polymerase used to generate sense riboprobe: T7
Hybridization Temperature: 60   Hybridization Temperature: 60