| PAP1 Gene | ||
| Human | Mouse | |
Click on the picture to see a full view |
Click on the picture to see a full view |
|
| View expression in a second eye sample | ||
| View Additional Template For This Gene | ||
| More Informations About This Gene | More Informations About This Gene | |
| View Sense Control | View Sense Control | |
| Template Source: | Template Source | |
| PCR product using the following primers: Primer-F: GTCGTCCCGGCCTGGGCGCG Primer-R: CCGCTTCTGCTCCCGACGTC |
plasmid kindly provided by Dr Hiroyoshi Ariga (Maita H, et al. Eur J Biochem. 2000;267(16):5168-78.) | |
| Template Size (bp): 100 | Template Size (bp): 1108 | |
| View Template Sequence | View Template Sequence | |
| Polymerase used to generate antisense riboprobe: T3 | Polymerase used to generate antisense riboprobe: T7 | |
| Polymerase used to generate sense riboprobe: T7 | Polymerase used to generate sense riboprobe: T3 | |
| Hybridization Temperature: 60 | Hybridization Temperature: 60 | |