Home >> Gene List Table >> MERTK
MERTK Gene
     
     
Human   Mouse

Click on the picture to see a full view
 
Click on the picture to see a full view
View expression in a second eye sample    
     
     
More Informations About This Gene   More Informations About This Gene
View Sense Control   View Sense Control
Template Source:   Template Source
plasmid kindly provided by Dr Douglas Vollrath (McHenry CL, et al. Invest Ophthalmol Vis Sci. 2004;45(5):1456-63.)   genomic PCR product obtained by using:

Primer-F: TACTCTTGCTGGAGTGCTGA
Primer-R: ATTTCACCTGGTGCTGTCCGG
 
 
 
Template Size (bp): 796   Template Size (bp): 979
View Template Sequence   View Template Sequence
Polymerase used to generate antisense riboprobe: T3  

Polymerase used to generate antisense riboprobe: T3

Polymerase used to generate sense riboprobe: SP6   Polymerase used to generate sense riboprobe: T7
Hybridization Temperature: 60   Hybridization Temperature: 60