GUCA1B Gene | ||
Human | Mouse | |
![]() Click on the picture to see a full view |
![]() Click on the picture to see a full view |
|
View expression in a second eye sample | ||
More Informations About This Gene | More Informations About This Gene | |
View Sense Control | View Sense Control | |
Template Source: | Template Source | |
genomic PCR product obtained by using: Primer-F: GAGGGGCGTTCATGGGGAGG Primer-R: GTGACCCAGGGCACTGGTTT |
genomic PCR product obtained by using: Primer-F: GGGTAATGAAGATGCTACAA Primer-R: ATGTGACACTGGTCCTACTTA |
|
Template Size (bp): 630 | Template Size (bp): 961 | |
View Template Sequence | View Template Sequence | |
Polymerase used to generate antisense riboprobe: T3 | Polymerase used to generate antisense riboprobe: T3 |
|
Polymerase used to generate sense riboprobe: T7 | Polymerase used to generate sense riboprobe: T7 | |
Hybridization Temperature: 65 | Hybridization Temperature: 65 | |