| FSCN2 Gene | ||
| Human | Mouse | |
Click on the picture to see a full view |
Click on the picture to see a full view |
|
| View expression in a second eye sample | ||
| More Informations About This Gene | More Informations About This Gene | |
| View Sense Control | View Sense Control | |
| Template Source: | Template Source | |
| genomic PCR product obtained by using: Primer-F: CCCGGCCAGCCTGAAGATGC Primer-R: GTGACTCTCCTCCAGATCAA |
plasmid kindly provided by Dr Pierre D. McCrea (Tao YS, et al. J Cell Biol. 1996;134(5):1271-81.) | |
| Template Size (bp): 790 | Template Size (bp): 751 | |
| View Template Sequence | View Template Sequence | |
| Polymerase used to generate antisense riboprobe: T3 | Polymerase used to generate antisense riboprobe: T3 | |
| Polymerase used to generate sense riboprobe: T7 | Polymerase used to generate sense riboprobe: T7 | |
| Hybridization Temperature: 65 | Hybridization Temperature: 65 | |