| CRX Gene | ||
| Human | Mouse | |
Click on the picture to see a full view |
Click on the picture to see a full view |
|
| View expression in a second eye sample | ||
| More Informations About This Gene | More Informations About This Gene | |
| View Sense Control | View Sense Control | |
| Template Source: | Template Source | |
| plasmid kindly provided by Dr Rod McInnes (Freund CL, et al. Cell. 1997;91(4):543-53.) | RT-PCR product obtained by using: Primer-F: CATCCAGGAGAGTCCCCATTT Primer-R: GACAGCCTGGTGCATCAGG |
|
| Template Size (bp): 1600 | Template Size (bp): 1284 | |
| View Template Sequence | View Template Sequence | |
| Polymerase used to generate antisense riboprobe: T7 | Polymerase used to generate antisense riboprobe: T7 |
|
| Polymerase used to generate sense riboprobe: T3 | Polymerase used to generate sense riboprobe: T3 | |
| Hybridization Temperature: 60 | Hybridization Temperature: 60 | |