| NRL PROBE-2 | ||
| 62658 | ||
| Human | ||
 |
||
| View expression in a second eye sample | ||
| More Informations About This Gene | ||
| View Sense Control | ||
| Template Source: | ||
| PCR product using the following primers: Primer-F: GCTGAGCAGAGGCACCAGGC Primer-R: TTCAGAAATGGCCGAGAGGA |
||
| Template Size (bp): 104 | ||
| View Template Sequence | ||
| Polymerase used to generate antisense riboprobe: T3 | ||
| Polymerase used to generate sense riboprobe: T7 | ||
| Hybridization Temperature: 65 | ||