USH2A PROBE-1 | ||
Human | ||
View expression in a second eye sample | ||
More Informations About This Gene | ||
View Sense Control | ||
Template Source: | ||
PCR product using the following primers: Primer-F: GCCATTGCTAAGAACGTCGT Primer-R: TCAGGTTTCAGCCATACAGC |
||
Template Size (bp): 650 | ||
View Template Sequence | ||
Polymerase used to generate antisense riboprobe: T3 | ||
Polymerase used to generate sense riboprobe: T7 | ||
Hybridization Temperature: 60 | ||